HUGE

Gene/Protein Characteristic Table for KIAA0654

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00592
Accession No. :	AB014554
Description :	Liprin-alpha-3.
HUGO Gene Name :	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3 (PPFIA3)
Clone Name :	fh18335 [Vector Info]
Flexi ORF Clone :	pF1KSDA0654
Source :	Human fetal brain
Note :	We replaced hk01750, former representative clones for KIAA0654 with fh18335. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 4716 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 799 bp

Genome contig ID gi42406306f_54214475
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTCACTCAGTGATCACGGGTAAAGAGAACTGTTTC
Flanking genome sequence
(131617 - 131666)
----+----*----+----*----+----*----+----*----+----*
AAAAAGCTTCCTTGTTGACTGATTTTTTTTTTGCGGGGGGGGGGGGGGCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 54314475 54346090 30 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1267 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75145	100.0	Liprin-alpha-3;...	Homo sapiens
AAI01519	99.9	Protein tyrosin...	Homo sapiens
XP_581408	99.2	similar to PTPR...	Bos taurus
XP_341857	94.7	similar to Lipr...	Rattus norvegicus
ACE63189	98.1	liprin-alpha 3 ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020704	5.5e-40	66.7	KIAA0897
AB033056	0.00019	24.3	KIAA1230

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001660 909 975 PF00536 Sterile alpha motif SAM

IPR001660 1024 1088 PF00536 Sterile alpha motif SAM

IPR011510 1111 1183 PF07647 Sterile alpha motif homology 2

HMMSmart IPR001660 908 977 SM00454 Sterile alpha motif SAM

IPR001660 1023 1090 SM00454 Sterile alpha motif SAM

IPR001660 1111 1183 SM00454 Sterile alpha motif SAM

ProfileScan IPR001660 911 977 PS50105 Sterile alpha motif SAM

IPR001660 1033 1090 PS50105 Sterile alpha motif SAM

IPR001660 1114 1183 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	909	975	PF00536	Sterile alpha motif SAM
IPR001660	1024	1088	PF00536	Sterile alpha motif SAM
IPR011510	1111	1183	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	908	977	SM00454	Sterile alpha motif SAM
IPR001660	1023	1090	SM00454	Sterile alpha motif SAM
IPR001660	1111	1183	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	911	977	PS50105	Sterile alpha motif SAM
IPR001660	1033	1090	PS50105	Sterile alpha motif SAM
IPR001660	1114	1183	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GGGATTATGTGCCTGAAACGG

Primer_r
: TCGTGGCAAATTCCTTCAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGGATTATGTGCCTGAAACGG
Primer_r	: TCGTGGCAAATTCCTTCAGGC
PCR product length	: 154 (0.4k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	799 bp
Genome contig ID	gi42406306f_54214475
PolyA signal sequence (None)	+--------+--------+----*----+---- GTCACTCAGTGATCACGGGTAAAGAGAACTGTTTC
Flanking genome sequence (131617 - 131666)	----+--------+--------+--------+--------+----* AAAAAGCTTCCTTGTTGACTGATTTTTTTTTTGCGGGGGGGGGGGGGGCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	54314475	54346090	30	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0654

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information