HUGE

Gene/Protein Characteristic Table for KIAA0649

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00590
Accession No. :	AB014549
Description :	1A6/DRIM (down-regulated in metastasis) interacting protein.
HUGO Gene Name :
Clone Name :	hj04122 [Vector Info]
Flexi ORF Clone :	pF1KSDA0649
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4932 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1253 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_520352	0	98.3	1A6/DRIM (down-...	Pan troglodytes
XP_001917418	7.5e-131	63.4	similar to 1A6/...	Equus caballus
XP_876074	5.7e-118	53.4	similar to 1A6/...	Bos taurus
XP_548400	3.6e-77	58.6	hypothetical pr...	Canis lupus fam...
EDL08380	1.8e-63	54.6	mCG59727 [Mus m...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTTTATACAGAGGACACCGCC

Primer_r
: GACATGCAACAGGGAGTAGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTTTATACAGAGGACACCGCC
Primer_r	: GACATGCAACAGGGAGTAGCC
PCR product length	: 144 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0649

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information