HUGE

Gene/Protein Characteristic Table for KIAA0646

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00589
Accession No. :	AB014546
Description :	E3 ubiquitin-protein ligase RNF8.
HUGO Gene Name :	ring finger protein 8 (RNF8)
Clone Name :	hj03808 [Vector Info]
Flexi ORF Clone :	pF1KSDA0646
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5545 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3975 bp

Genome contig ID gi89161210f_37329807
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACTCTGCATGTATTCAATAAATTCAATTCAGCAAT
Flanking genome sequence
(140682 - 140731)
----+----*----+----*----+----*----+----*----+----*
AGTTATCAAATGCCCATTTTCTTACTAGGCACTGCTCTAGGTGTTTGGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 37429807 37470487 8 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 486 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O76064	1.7e-152	100.0	E3 ubiquitin-pr...	Homo sapiens
AAP36421	1.7e-152	100.0	ring finger pro...	synthetic construct
BAD96485	4.2e-152	99.6	ring finger pro...	Homo sapiens
EAX03943	5.2e-152	99.6	ring finger pro...	Homo sapiens
BAE87261	3.1e-147	97.1	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000253 39 110 PF00498 Forkhead-associated

IPR001841 404 441 PF00097 Zinc finger

HMMSmart IPR000253 38 93 SM00240 Forkhead-associated

IPR001841 404 441 SM00184 Zinc finger

ProfileScan IPR000253 39 93 PS50006 Forkhead-associated

IPR001841 404 442 PS50089 Zinc finger

ScanRegExp IPR001841 419 428 PS00518 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000253	39	110	PF00498	Forkhead-associated
IPR001841	404	441	PF00097	Zinc finger
HMMSmart	IPR000253	38	93	SM00240	Forkhead-associated
IPR001841	404	441	SM00184	Zinc finger
ProfileScan	IPR000253	39	93	PS50006	Forkhead-associated
IPR001841	404	442	PS50089	Zinc finger
ScanRegExp	IPR001841	419	428	PS00518	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCCAAACAATGTACCAGTG

Primer_r
: AGTGGACAGCAGAGATAGTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCCCAAACAATGTACCAGTG
Primer_r	: AGTGGACAGCAGAGATAGTGG
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3975 bp
Genome contig ID	gi89161210f_37329807
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACTCTGCATGTATTCAATAAATTCAATTCAGCAAT
Flanking genome sequence (140682 - 140731)	----+--------+--------+--------+--------+----* AGTTATCAAATGCCCATTTTCTTACTAGGCACTGCTCTAGGTGTTTGGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	37429807	37470487	8	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0646

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information