HUGE

Gene/Protein Characteristic Table for KIAA0607

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00573
Accession No. :	AB011179
Description :	neurochondrin isoform 2.
HUGO Gene Name :
Clone Name :	hh00181a [Vector Info]
Flexi ORF Clone :	pF1KSDA0607
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3311 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1114 bp

Genome contig ID gi89161185f_35696032
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGCACATGTGGACACTCAATAAATGTTCATTGGTG
Flanking genome sequence
(108930 - 108979)
----+----*----+----*----+----*----+----*----+----*
ACGAGAAGCCTCCTGCGTGGTCTGCCCTGCACCTGCTCTCTCCCTTCCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 35796032 35804960 7 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 731 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001102087	99.7	similar to neur...	Macaca mulatta
XP_513308	99.9	neurochondrin [...	Pan troglodytes
AAD05029	99.3	unknown [Homo s...	Homo sapiens
Q9UBB6	99.3	Neurochondrin.	Homo sapiens
BAA77831	100.0	neurochondrin-2...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008709 20 731 PF05536 Neurochondrin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008709	20	731	PF05536	Neurochondrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CCTGTCCTTATCCCTGCTTGG

Primer_r
: GTAATCACTGGGGAAACATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTGTCCTTATCCCTGCTTGG
Primer_r	: GTAATCACTGGGGAAACATGC
PCR product length	: 126 bp
PCR conditions	: 95 °C15 sec67 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1114 bp
Genome contig ID	gi89161185f_35696032
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGCACATGTGGACACTCAATAAATGTTCATTGGTG
Flanking genome sequence (108930 - 108979)	----+--------+--------+--------+--------+----* ACGAGAAGCCTCCTGCGTGGTCTGCCCTGCACCTGCTCTCTCCCTTCCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	35796032	35804960	7	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0607

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information