ROUGE |
Gene/Protein Characteristic Table for mKIAA0607 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122327 |
---|---|
neurochondrin. neurochondrin-1. neurochondrin-2. minisatellite 10ae detected by probe MMS10. |
|
mbh00762 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3034 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1073 bp Genome contig ID gi65493515r_125670928 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TGCACATGTGGACACTCAATAAATGTTTATTGGTGFlanking genome sequence
(99948 - 99899) ----+----*----+----*----+----*----+----*----+----*
ATGAGAAGCCTCCTTTGTGGTCTGCCTTGCACCTCCTCTGCCTTAACCTG
KIAA Alignment based on: KIAA0607 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1961
Length: 652 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |