| HUGE |
Gene/Protein Characteristic Table for KIAA0596 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01981 |
|---|---|
| Accession No. : | AB011168 |
| Description : | mitogen activated protein kinase binding protein 1. |
| HUGO Gene Name : | mitogen-activated protein kinase binding protein 1 (MAPKBP1) |
| Clone Name : | hg01605 [Vector Info] |
| Flexi ORF Clone : | pF1KA0596
|
| Source : | Human adult brain |
| Note : | We replaced hj02942, former representative clones for KIAA0596 with hg01605. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7161 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2420 bp Genome contig ID gi51511731f_39754014 PolyA signal sequence
(AATAAA,-20)
ATGTATGAACTTGTCAATAAACACAATTGTTTGTTFlanking genome sequence
(153331 - 153380)
AACCCTGGGATGCCGGCCAGTGGGGCAGGCCGAAGCGGGCGCTGCCAGTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 39854014 39907343 31 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1531 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : GTAGATGGGACAGGTAAGTGG | |
| : CAACTCTTCAACTGCCTCACG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 15 |
| : GeneBridge 4 | |
| : GTAGATGGGACAGGTAAGTGG | |
| : CAACTCTTCAACTGCCTCACG | |
| : 136 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
