HUGE

Gene/Protein Characteristic Table for KIAA0556

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01093
Accession No. :	AB011128
Description :
HUGO Gene Name :
Clone Name :	hg03732 [Vector Info]
Flexi ORF Clone :	pF1KA0556
Source :	Human adult brain
Note :	We replaced hh00892, former representative clones for KIAA0556 with hg03732. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 6618 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1739 bp

Genome contig ID gi51511732f_27392722
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTCTTGCAAAATTAATAAAAGATGTTATTAAGAAT
Flanking genome sequence
(306470 - 306519)
----+----*----+----*----+----*----+----*----+----*
ATAGTCCGAGTCACCGGATTTGGGGTCAGATGGGGAGTCCATGCTGCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 27492718 27699190 27 100.0 Terminal No-hit

Features of the protein sequence	Description

Length: 1625 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056017	99.9	hypothetical pr...	Homo sapiens
XP_001094464	94.8	similar to K04F...	Macaca mulatta
XP_536927	76.5	similar to K04F...	Canis lupus fam...
AAI58020	72.8	RIKEN cDNA D430...	Mus musculus
EDL17335	70.4	mCG20545, isofo...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR002047 1220 1227 PS00256 Adipokinetic hormone

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR002047	1220	1227	PS00256	Adipokinetic hormone

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GTGTCGTGTTAGTGCCATCTC

Primer_r
: TGTGACCCAAACCAGTGCCGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTGTCGTGTTAGTGCCATCTC
Primer_r	: TGTGACCCAAACCAGTGCCGC
PCR product length	: 133 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1739 bp
Genome contig ID	gi51511732f_27392722
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTCTTGCAAAATTAATAAAAGATGTTATTAAGAAT
Flanking genome sequence (306470 - 306519)	----+--------+--------+--------+--------+----* ATAGTCCGAGTCACCGGATTTGGGGTCAGATGGGGAGTCCATGCTGCCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	27492718	27699190	27	100.0	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0556

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information