HUGE

Gene/Protein Characteristic Table for KIAA0554

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00561
Accession No. :	AB011126
Description :	Formin-binding protein 1.
HUGO Gene Name :	formin binding protein 1 (FNBP1)
Clone Name :	hh00877 [Vector Info]
Flexi ORF Clone :	pF1KSDA0554
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5383 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3356 bp

Genome contig ID gi89161216r_131589287
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGTTAATCTCGTGTTAAAATAAAATATAACTTGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GCTCCGTGTCACGGGACTGTTTTGTTGCATGAAGATATGACCCTAGTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 131689287 131845248 16 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 674 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAK49824	3.5e-215	100.0	formin-binding ...	Homo sapiens
EAW87916	3.1e-212	99.3	formin binding ...	Homo sapiens
Q96RU3	1.5e-194	100.0	Formin-binding ...	Homo sapiens
CAI12149	2.5e-193	99.5	formin binding ...	Homo sapiens
AAI43514	2.7e-192	99.2	FNBP1 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 613 664 PD000066 Src homology-3

FPrintScan IPR001452 610 620 PR00452 Src homology-3

IPR001452 624 639 PR00452 Src homology-3

IPR001452 654 666 PR00452 Src homology-3

HMMPfam IPR001060 58 151 PF00611 Cdc15/Fes/CIP4

IPR001452 610 666 PF00018 Src homology-3

HMMSmart IPR001060 58 151 SM00055 Cdc15/Fes/CIP4

IPR001452 610 667 SM00326 Src homology-3

ProfileScan IPR001060 58 122 PS50133 Cdc15/Fes/CIP4

IPR001452 607 664 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	613	664	PD000066	Src homology-3
FPrintScan	IPR001452	610	620	PR00452	Src homology-3
IPR001452	624	639	PR00452	Src homology-3
IPR001452	654	666	PR00452	Src homology-3
HMMPfam	IPR001060	58	151	PF00611	Cdc15/Fes/CIP4
IPR001452	610	666	PF00018	Src homology-3
HMMSmart	IPR001060	58	151	SM00055	Cdc15/Fes/CIP4
IPR001452	610	667	SM00326	Src homology-3
ProfileScan	IPR001060	58	122	PS50133	Cdc15/Fes/CIP4
IPR001452	607	664	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GGTTTAATTCCATCTCCAGAG

Primer_r
: TTTTGCTGTGTGAGGCCGATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGTTTAATTCCATCTCCAGAG
Primer_r	: TTTTGCTGTGTGAGGCCGATC
PCR product length	: 147 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3356 bp
Genome contig ID	gi89161216r_131589287
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGTTAATCTCGTGTTAAAATAAAATATAACTTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCTCCGTGTCACGGGACTGTTTTGTTGCATGAAGATATGACCCTAGTTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	131689287	131845248	16	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0554

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information