HUGE

Gene/Protein Characteristic Table for KIAA0513

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00549
Accession No. :	AB011085
Description :
HUGO Gene Name :
Clone Name :	hf00293 [Vector Info]
Flexi ORF Clone :	pF1KSDA0513
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 7758 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5891 bp

Genome contig ID gi51511732f_83554319
PolyA signal sequence
(AATAAA,-14)
+----*----+----*----+----*----+----
TTGTCAGAAGGTAGAAACTGAAATAAACTAACTTT
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 83654319 83693065 15 98.8 Terminal No-hit

Features of the protein sequence	Description

Length: 412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001113080	3.7e-166	98.1	hypothetical pr...	Macaca mulatta
EDL92696	6.5e-150	88.6	similar to RIKE...	Rattus norvegicus
BAC32067	1e-149	88.6	unnamed protein...	Mus musculus
BAC27873	1.2e-149	88.6	unnamed protein...	Mus musculus
BAC32707	1.8e-149	88.6	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACCGAGCGGGACACAAGATTG

Primer_r
: TCACATCCAGACATTACCTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACCGAGCGGGACACAAGATTG
Primer_r	: TCACATCCAGACATTACCTTG
PCR product length	: 98 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	5891 bp
Genome contig ID	gi51511732f_83554319
PolyA signal sequence (AATAAA,-14)	+--------+--------+----*----+---- TTGTCAGAAGGTAGAAACTGAAATAAACTAACTTT
Flanking genome sequence	None

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	83654319	83693065	15	98.8	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0513

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information