HUGE

Gene/Protein Characteristic Table for KIAA0491

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00089
Accession No. :	AB007960
Description :	SH3 domain GRB2-like protein B1.
HUGO Gene Name :	SH3-domain GRB2-like endophilin B1 (SH3GLB1)
Clone Name :	ha02617 [Vector Info]
Flexi ORF Clone :	pF1KA0491
Source :	Myeloblast cell line (KG-1)
Note :	We replaced hh00916, former representative clones for KIAA0491 with ha02617. (1998/8/13)

Features of the cloned DNA sequence	Description

Length: 6335 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4942 bp

Genome contig ID gi89161185f_86842892
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
AGGTTTCCAACTTTCATTAATAAAGTGCTTTAAAG
Flanking genome sequence
(143561 - 143610)
----+----*----+----*----+----*----+----*----+----*
AACATTGTGTTGCTAAATCTCGTATGTGTTCATATTTTCTCACGATAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 86942892 86986451 9 99.1 Terminal No-hit

Features of the protein sequence	Description

Length: 391 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y371	1.4e-142	100.0	Endophilin-B1; ...	Homo sapiens
XP_001109639	2.9e-142	99.7	SH3-containing ...	Macaca mulatta
AAF81225	2.3e-141	100.0	SH3-containing ...	Homo sapiens
Q32LM0	4.4e-137	95.9	Endophilin-B1; ...	Bos taurus
Q9JK48	7.5e-136	95.9	Endophilin-B1; ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058751	1.8e-43	58.3	KIAA1848

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 335 388 PD000066 Src homology-3

FPrintScan IPR001452 334 344 PR00452 Src homology-3

IPR001452 348 363 PR00452 Src homology-3

IPR001452 378 390 PR00452 Src homology-3

HMMPfam IPR004148 37 280 PF03114 BAR

IPR001452 334 390 PF00018 Src homology-3

HMMSmart IPR004148 36 280 SM00721 BAR

IPR001452 334 391 SM00326 Src homology-3

ProfileScan IPR004148 53 287 PS51021 BAR

IPR001452 331 391 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	335	388	PD000066	Src homology-3
FPrintScan	IPR001452	334	344	PR00452	Src homology-3
IPR001452	348	363	PR00452	Src homology-3
IPR001452	378	390	PR00452	Src homology-3
HMMPfam	IPR004148	37	280	PF03114	BAR
IPR001452	334	390	PF00018	Src homology-3
HMMSmart	IPR004148	36	280	SM00721	BAR
IPR001452	334	391	SM00326	Src homology-3
ProfileScan	IPR004148	53	287	PS51021	BAR
IPR001452	331	391	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCAGGGGACCATTTTAGATAC
Primer_r	: ATCCCCCGAACAAACCTCAAG
PCR product length	: 73 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4942 bp
Genome contig ID	gi89161185f_86842892
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AGGTTTCCAACTTTCATTAATAAAGTGCTTTAAAG
Flanking genome sequence (143561 - 143610)	----+--------+--------+--------+--------+----* AACATTGTGTTGCTAAATCTCGTATGTGTTCATATTTTCTCACGATAAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	86942892	86986451	9	99.1	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0491

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information