HUGE |
Gene/Protein Characteristic Table for KIAA0488 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK06932 |
---|---|
Accession No. : | AB007957 |
Description : | Sorting nexin-27. |
HUGO Gene Name : | sorting nexin family member 27 (SNX27) |
Clone Name : | af14633 [Vector Info] |
Source : | Human brain (amygdala) |
Note : | We replaced hg00965, former representative clones for KIAA0488 with af14633. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7056 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5484 bp Genome contig ID gi89161185f_149751317 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
ATATTCTTTTAAATAAATTGATTTATTGATCAAACFlanking genome sequence
(186864 - 186913) ----+----*----+----*----+----*----+----*----+----*
ACTTCTTTGGTTTCCTAGACTACAAATCCTTTGGGTTGTGTGGGAAGAAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 149851317 149938179 12 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 523 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: GAGTTTGCTATCCTACACCAG | |
: GTCACTCTCACCAATTACTCG | |
: 174 (2.5k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |