Gene/Protein Characteristic Table for KIAA0488

Length: 7056 bp

Restriction map

Length of 3'UTR	5484 bp
Genome contig ID	gi89161185f_149751317
PolyA signal sequence (AATAAA,-24)	+----*----+----*----+----*----+---- ATATTCTTTTAAATAAATTGATTTATTGATCAAAC
Flanking genome sequence (186864 - 186913)	----+----*----+----*----+----*----+----*----+----* ACTTCTTTGGTTTCCTAGACTACAAATCCTTTGGGTTGTGTGGGAAGAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	149851317	149938179	12	99.2	Perfect prediction

Length: 523 aa

Entry Exp ID% Protein Source CAH73501 7.8e-197 100.0 sorting nexin f... Homo sapiens XP_001172506 5e-196 100.0 sorting nexin f... Pan troglodytes Q96L92 5.1e-196 100.0 Sorting nexin-27. Homo sapiens ABY40802 8.7e-196 99.8 sorting nexin f... Papio anubis ACA57940 9.9e-196 99.6 sorting nexin f... Callicebus moloch

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID D31764 2.7e-14 25.7 KIAA0064

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	38	128	PF00595	PDZ/DHR/GLGF
	IPR001683	156	260	PF00787	Phox-like
	IPR000159	268	357	PF00788	Ras-association
HMMSmart	IPR001478	46	131	SM00228	PDZ/DHR/GLGF
	IPR001683	151	260	SM00312	Phox-like
ProfileScan	IPR001478	38	131	PS50106	PDZ/DHR/GLGF
	IPR001683	156	264	PS50195	Phox-like
	IPR000159	268	357	PS50200	Ras-association

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-