| HUGE |
Gene/Protein Characteristic Table for KIAA0064 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00391 |
|---|---|
| Accession No. : | D31764 |
| Description : | Sorting nexin-17. |
| HUGO Gene Name : | sorting nexin 17 (SNX17) |
| Clone Name : | ha01355 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0064
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2043 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 408 bp Genome contig ID gi89161199f_27346893 PolyA signal sequence
(ATTAAA,-25)
GTTCCCCATCATTAAACTCAGCCTGACTGCTGCCTFlanking genome sequence
(106607 - 106656)
ACCTCTGGTTCCCTCTCACTGCCCCTGCTTCCCCCATCACAGCATGGACT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 27446893 27453498 15 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 495 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : Stanford G3 | |
| : TGCTTGGATGTCTGCCCTCTA | |
| : CAAGGAAAGGTAGGATACGAG | |
| : 152 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
