HUGE

Gene/Protein Characteristic Table for KIAA0470

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00544
Accession No. :	AB007939
Description :	Centrosomal protein of 170 kDa.
HUGO Gene Name :
Clone Name :	hg01996 [Vector Info]
Flexi ORF Clone :	pF1KSDA0470
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6456 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1472 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA83380	100.0	KARP-1-binding ...	Homo sapiens
CAI12945	99.9	centrosomal pro...	Homo sapiens
XP_514307	99.9	centrosomal pro...	Pan troglodytes
XP_001091357	98.8	similar to cent...	Macaca mulatta
XP_001090630	99.0	similar to cent...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB006622	1.2e-18	32.6	KIAA0284

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000253 35 102 PF00498 Forkhead-associated

HMMSmart IPR000253 34 85 SM00240 Forkhead-associated

ProfileScan IPR000253 35 85 PS50006 Forkhead-associated

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000253	35	102	PF00498	Forkhead-associated
HMMSmart	IPR000253	34	85	SM00240	Forkhead-associated
ProfileScan	IPR000253	35	85	PS50006	Forkhead-associated

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACATCCTGGTTTTTGGTGAGC
Primer_r	: ACACTACGAGACTGCAACATG
PCR product length	: 107 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0470

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information