HUGE

Gene/Protein Characteristic Table for KIAA0284

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK05588
Accession No. :	AB006622
Description :	K0284_HUMAN Isoform 3 of Q9Y4F5 - Homo sapiens.
HUGO Gene Name :
Clone Name :	pf09542 [Vector Info]
Flexi ORF Clone :	pF1KA0284
Source :	Human brain (hippocampus)
Note :	We replaced ha06488, former representative clones for KIAA0284 with pf09542. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 6677 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1784 bp

Genome contig ID gi51511730f_104302695
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATGGAATTTGTTCTAATAAATCATTCTTCTATCAC
Flanking genome sequence
(131430 - 131479)
----+----*----+----*----+----*----+----*----+----*
ATGGCAGCACGCTGGAGCCTGTCACCTTGGCCTTGTTTCTCTATCCTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 104402695 104434123 19 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1573 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001106197	99.9	hypothetical pr...	Homo sapiens
NP_055820	99.9	hypothetical pr...	Homo sapiens
XP_001085960	92.7	similar to KARP...	Macaca mulatta
XP_001085858	92.9	similar to KARP...	Macaca mulatta
XP_548002	77.9	similar to KARP...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007939	1.6e-11	32.3	KIAA0470

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000253 42 109 PF00498 Forkhead-associated

HMMSmart IPR000253 41 92 SM00240 Forkhead-associated

ProfileScan IPR000253 42 92 PS50006 Forkhead-associated

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000253	42	109	PF00498	Forkhead-associated
HMMSmart	IPR000253	41	92	SM00240	Forkhead-associated
ProfileScan	IPR000253	42	92	PS50006	Forkhead-associated

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTGTCTGTATGGAGGAGGTGC
Primer_r	: AGCCGTGGATGAAGCGTGACC
PCR product length	: 117 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1784 bp
Genome contig ID	gi51511730f_104302695
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATGGAATTTGTTCTAATAAATCATTCTTCTATCAC
Flanking genome sequence (131430 - 131479)	----+--------+--------+--------+--------+----* ATGGCAGCACGCTGGAGCCTGTCACCTTGGCCTTGTTTCTCTATCCTTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	104402695	104434123	19	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0284

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information