HUGE

Gene/Protein Characteristic Table for KIAA0451

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04505
Accession No. :	AB007920
Description :	Serine/threonine-protein kinase MRCK alpha.
HUGO Gene Name :	CDC42 binding protein kinase alpha (DMPK-like) (CDC42BPA)
Clone Name :	pf06424 [Vector Info]
Source :	Human brain (hippocampus)
Note :	We replaced hg00286, former representative clones for KIAA0451 with pf06424. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 7335 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4382 bp

Genome contig ID gi89161185r_225144190
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GACTTTGCTGTATTGCAATAAAACAGAGAACTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCATTGAGTATTTTGTCTCTTTTCCCCCCACTTGAAAGTCTGAGAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 225244190 225335303 22 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 983 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI19112	99.8	CDC42 binding p...	Homo sapiens
XP_001088134	98.9	similar to CDC4...	Macaca mulatta
XP_863624	96.3	similar to CDC4...	Canis lupus fam...
CAH71184	93.5	CDC42 binding p...	Homo sapiens
CAH71183	93.5	CDC42 binding p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032950	9.6e-93	52.1	KIAA1124
AB023166	0.00012	21.8	KIAA0949

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002219 199 213 PR00008 Protein kinase C

IPR002219 215 224 PR00008 Protein kinase C

IPR002219 228 239 PR00008 Protein kinase C

IPR002219 240 252 PR00008 Protein kinase C

HMMPfam IPR014930 83 143 PF08826 DMPK coiled coil

IPR002219 202 254 PF00130 Protein kinase C

IPR001849 272 390 PF00169 Pleckstrin-like

IPR001180 417 688 PF00780 Citron-like

HMMSmart IPR002219 202 251 SM00109 Protein kinase C

IPR001849 272 392 SM00233 Pleckstrin-like

IPR001180 417 699 SM00036 Citron-like

IPR000095 760 795 SM00285 PAK-box/P21-Rho-binding

IPR000095 801 838 SM00285 PAK-box/P21-Rho-binding

ProfileScan IPR002219 201 251 PS50081 Protein kinase C

IPR001849 271 390 PS50003 Pleckstrin-like

IPR000095 760 773 PS50108 PAK-box/P21-Rho-binding

IPR000095 801 814 PS50108 PAK-box/P21-Rho-binding

ScanRegExp IPR002219 202 251 PS00479 Protein kinase C

IPR001304 218 239 PS00615 C-type lectin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002219	199	213	PR00008	Protein kinase C
IPR002219	215	224	PR00008	Protein kinase C
IPR002219	228	239	PR00008	Protein kinase C
IPR002219	240	252	PR00008	Protein kinase C
HMMPfam	IPR014930	83	143	PF08826	DMPK coiled coil
IPR002219	202	254	PF00130	Protein kinase C
IPR001849	272	390	PF00169	Pleckstrin-like
IPR001180	417	688	PF00780	Citron-like
HMMSmart	IPR002219	202	251	SM00109	Protein kinase C
IPR001849	272	392	SM00233	Pleckstrin-like
IPR001180	417	699	SM00036	Citron-like
IPR000095	760	795	SM00285	PAK-box/P21-Rho-binding
IPR000095	801	838	SM00285	PAK-box/P21-Rho-binding
ProfileScan	IPR002219	201	251	PS50081	Protein kinase C
IPR001849	271	390	PS50003	Pleckstrin-like
IPR000095	760	773	PS50108	PAK-box/P21-Rho-binding
IPR000095	801	814	PS50108	PAK-box/P21-Rho-binding
ScanRegExp	IPR002219	202	251	PS00479	Protein kinase C
IPR001304	218	239	PS00615	C-type lectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATTGGTGAGGAGTCTTTTGTG
Primer_r	: TTTATGCCCTCAGTGTCTTAG
PCR product length	: 128 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4382 bp
Genome contig ID	gi89161185r_225144190
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GACTTTGCTGTATTGCAATAAAACAGAGAACTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCATTGAGTATTTTGTCTCTTTTCCCCCCACTTGAAAGTCTGAGAAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	225244190	225335303	22	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0451

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information