HUGE

Gene/Protein Characteristic Table for KIAA0418

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00072
Accession No. :	AB007878
Description :	SH3 and PX domain-containing protein 2A.
HUGO Gene Name :	SH3 and PX domains 2A (SH3PXD2A)
Clone Name :	hh00988 [Vector Info]
Flexi ORF Clone :	pF1KA0418
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5504 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2296 bp

Genome contig ID gi89161187r_105249267
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AATTTATGACTATTTAAAATAAAATTTAAAAGTAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTGACTGTCAGGTAAAGAACCTTCAATGTAGCTATCTTCCAGGGGGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 105349267 105443371 12 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 989 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI13961	98.9	SH3 and PX doma...	Homo sapiens
EAW49625	98.9	SH3 and PX doma...	Homo sapiens
BAH14354	99.9	unnamed protein...	Homo sapiens
BAH12146	99.8	unnamed protein...	Homo sapiens
XP_508015	98.7	SH3 multiple do...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037716	9.1e-08	27.2	KIAA1295

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 54 105 PD000066 Src homology-3

IPR001452 133 176 PD000066 Src homology-3

IPR001452 309 359 PD000066 Src homology-3

IPR001452 701 750 PD000066 Src homology-3

IPR001452 933 986 PD000066 Src homology-3

FPrintScan IPR001452 67 82 PR00452 Src homology-3

IPR001452 167 179 PR00452 Src homology-3

HMMPfam IPR001452 53 107 PF00018 Src homology-3

IPR001452 125 179 PF00018 Src homology-3

IPR001452 323 361 PF00018 Src homology-3

IPR001452 706 753 PF00018 Src homology-3

IPR001452 954 988 PF00018 Src homology-3

HMMSmart IPR001452 53 108 SM00326 Src homology-3

IPR001452 125 180 SM00326 Src homology-3

IPR001452 307 362 SM00326 Src homology-3

IPR001452 699 754 SM00326 Src homology-3

IPR001452 931 989 SM00326 Src homology-3

ProfileScan IPR001452 50 109 PS50002 Src homology-3

IPR001452 122 181 PS50002 Src homology-3

IPR001452 304 363 PS50002 Src homology-3

IPR001452 707 755 PS50002 Src homology-3

IPR001452 942 989 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	54	105	PD000066	Src homology-3
IPR001452	133	176	PD000066	Src homology-3
IPR001452	309	359	PD000066	Src homology-3
IPR001452	701	750	PD000066	Src homology-3
IPR001452	933	986	PD000066	Src homology-3
FPrintScan	IPR001452	67	82	PR00452	Src homology-3
IPR001452	167	179	PR00452	Src homology-3
HMMPfam	IPR001452	53	107	PF00018	Src homology-3
IPR001452	125	179	PF00018	Src homology-3
IPR001452	323	361	PF00018	Src homology-3
IPR001452	706	753	PF00018	Src homology-3
IPR001452	954	988	PF00018	Src homology-3
HMMSmart	IPR001452	53	108	SM00326	Src homology-3
IPR001452	125	180	SM00326	Src homology-3
IPR001452	307	362	SM00326	Src homology-3
IPR001452	699	754	SM00326	Src homology-3
IPR001452	931	989	SM00326	Src homology-3
ProfileScan	IPR001452	50	109	PS50002	Src homology-3
IPR001452	122	181	PS50002	Src homology-3
IPR001452	304	363	PS50002	Src homology-3
IPR001452	707	755	PS50002	Src homology-3
IPR001452	942	989	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCAGCTCAGATGTCACCTTCC

Primer_r
: CAGCAGGGGACGATGTGACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACTTTGCTCTCTGGGTTTTT
Primer_r	: TGGTAGTGGTTTAGTGTCTTC
PCR product length	: 126 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2296 bp
Genome contig ID	gi89161187r_105249267
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AATTTATGACTATTTAAAATAAAATTTAAAAGTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGACTGTCAGGTAAAGAACCTTCAATGTAGCTATCTTCCAGGGGGAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	105349267	105443371	12	99.2	Perfect prediction

Primer_f	: TCAGCTCAGATGTCACCTTCC
Primer_r	: CAGCAGGGGACGATGTGACAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0418

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information