| HUGE |
Gene/Protein Characteristic Table for KIAA0413 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04119 |
|---|---|
| Accession No. : | AB007873 |
| Description : | Apoptotic protease-activating factor 1. |
| HUGO Gene Name : | |
| Clone Name : | hh00077s1 [Vector Info] |
| Source : | Human adult brain |
| Note : | We replaced hh00077, former representative clones for KIAA0413 with hh00077s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6574 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2860 bp Genome contig ID gi89161190f_97466269 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
ATTTTTGTAAAAATAAAATTCACAAAATTGTTTTGFlanking genome sequence
(187068 - 187117) ----+----*----+----*----+----*----+----*----+----*
AAAAACATTTTTGGATTGTTTCATTCTTTGCTTGTCATTTATCTGTTGAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 97566269 97653335 26 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1237 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : CTCATCTGCAAACTACAAAAC | |
| : CATGAAGAAAGAAGAGATACC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 12 |
| : GeneBridge 4 | |
| : CTCATCTGCAAACTACAAAAC | |
| : CATGAAGAAAGAAGAGATACC | |
| : 155 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |