HUGE

Gene/Protein Characteristic Table for KIAA0410

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00529
Accession No. :	AB007870
Description :	Nucleoporin p58/p45.
HUGO Gene Name :	nucleoporin like 1 (NUPL1)
Clone Name :	hg01877 [Vector Info]
Flexi ORF Clone :	pF1KSDA0410
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6356 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4755 bp

Genome contig ID gi51511729f_24673769
PolyA signal sequence
(AATAAA,-8)
+----*----+----*----+----*----+----
ATTTGCTTTACAATGAACAATAAATTTAATAAAAT
Flanking genome sequence
(134711 - 134760)
----+----*----+----*----+----*----+----*----+----*
AAAACATTGTCTTGTTTTTTATCTACTTATTGTATATATCATTTATATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 24773769 24808478 13 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI39901	4.3e-146	100.0	nucleoporin lik...	Homo sapiens
EAX08370	1.6e-145	99.6	nucleoporin lik...	Homo sapiens
NP_001008565	3.1e-144	100.0	nucleoporin lik...	Homo sapiens
Q9BVL2	3.5e-144	100.0	Nucleoporin p58...	Homo sapiens
EAX08368	1.2e-143	99.6	nucleoporin lik...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029037	0.00068	32.2	KIAA1114
AB014518	0.001	29.1	KIAA0618

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACATTTACAAAGGCACCGCTG

Primer_r
: TGACTAATCGTTCTGCTTCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CATTACACCACTTATCACCTG
Primer_r	: AATCGTTCTGCTTCTGAGTAC
PCR product length	: 115 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4755 bp
Genome contig ID	gi51511729f_24673769
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- ATTTGCTTTACAATGAACAATAAATTTAATAAAAT
Flanking genome sequence (134711 - 134760)	----+--------+--------+--------+--------+----* AAAACATTGTCTTGTTTTTTATCTACTTATTGTATATATCATTTATATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	24773769	24808478	13	99.2	Perfect prediction

Primer_f	: ACATTTACAAAGGCACCGCTG
Primer_r	: TGACTAATCGTTCTGCTTCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0410

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information