| HUGE |
Gene/Protein Characteristic Table for KIAA0386 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01079 |
|---|---|
| Accession No. : | AB002384 |
| Description : | Protein FAM65B. |
| HUGO Gene Name : | family with sequence similarity 65, member B (FAM65B) |
| Clone Name : | hj00015 [Vector Info] |
| Flexi ORF Clone : | pF1KA0386
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5471 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2087 bp Genome contig ID gi89161210r_24812492 PolyA signal sequence
(AATAAA,-27) +----*----+----*----+----*----+----
TAAGTTAAAATAAAAATTATTTTTGAATTACTAGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATCATGTGCAGTCTGATGTTATTTTTTTTCACATGCCCTTTCTGAGTTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 r 24912492 25019174 23 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1085 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : AACTAAAAGCACCCCTCAACC | |
| : CTGTAGTTAGGAGGTATAGCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : GeneBridge 4 | |
| : AACTAAAAGCACCCCTCAACC | |
| : CTGTAGTTAGGAGGTATAGCC | |
| : 204 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |