HUGE

Gene/Protein Characteristic Table for KIAA1930

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04978
Accession No. :	AB067517
Description :	Protein FAM65A.
HUGO Gene Name :
Clone Name :	fj11193 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3960 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 321 bp

Genome contig ID gi51511732f_66029868
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GTTTTACAGAAAATAAAAAAGCAAAATGTCTTTCC
Flanking genome sequence
(108322 - 108371)
----+----*----+----*----+----*----+----*----+----*
TACATGGCCTGGTACACTCCTGACCCTCTGCTCCAACACCCTCTGGCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 66129868 66138188 21 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 664 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH54512	3.4e-176	98.8	FAM65A protein ...	Homo sapiens
CAD38982	3.4e-176	98.8	hypothetical pr...	Homo sapiens
AAH98587	3.7e-176	98.8	FAM65A protein ...	Homo sapiens
AAI56640	4.1e-176	98.8	Family with seq...	synthetic construct
Q6ZS17	4.1e-176	98.8	Protein FAM65A.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002384	3.3e-08	28.8	KIAA0386

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGCTCACAGTCTTCCAGTTC

Primer_r
: AGCACAACAGCCTGATCATCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	321 bp
Genome contig ID	gi51511732f_66029868
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTTTTACAGAAAATAAAAAAGCAAAATGTCTTTCC
Flanking genome sequence (108322 - 108371)	----+--------+--------+--------+--------+----* TACATGGCCTGGTACACTCCTGACCCTCTGCTCCAACACCCTCTGGCTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	66129868	66138188	21	99.6	Perfect prediction

Primer_f	: CAGCTCACAGTCTTCCAGTTC
Primer_r	: AGCACAACAGCCTGATCATCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1930

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information