HUGE |
Gene/Protein Characteristic Table for KIAA0377 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00062 |
---|---|
Accession No. : | AB002375 |
Description : | histidine acid phosphatase domain containing 2A isoform 2. |
HUGO Gene Name : | histidine acid phosphatase domain containing 2B (pseudogene) (HISPPD2B) |
Clone Name : | hh00412 [Vector Info] |
Flexi ORF Clone : | pF1KA0377
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5544 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1197 bp Genome contig ID gi51511731r_41512967 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
ACATTATGAGTGCTCAATAAATATAAACTAATGAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATGGTGGTGATGGATGATGGTGATGTCCTTGTGAATTCAAGAATGAATA
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 r 41612967 41664386 29 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1412 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000560 | 396 | 912 | PF00328 | Histidine acid phosphatase |
ScanRegExp | IPR000560 | 397 | 411 | PS00616 | Histidine acid phosphatase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GCACTCATAATGTTCCAGCCC | |
: CAAAGACCAAACACTGCAGGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: GeneBridge 4 | |
: GCACTCATAATGTTCCAGCCC | |
: CAAAGACCAAACACTGCAGGG | |
: 166 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |