ROUGE

Gene/Protein Characteristic Table for mKIAA0377

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122264
Description :	RIKEN cDNA B430315C20 gene.
Clone Name :	mbg05380 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5492 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1090 bp

Genome contig ID gi66880554r_120724413
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACATGACAAGTGCTCAATAAACACAAAATAATGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACGAGGGGGTGTGACTCCTTTGTGACCTTTGTGAACTCAAGAATGAATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0377 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0377	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 74..4402
Length: 1442 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
A2ARP1	99.9	Inositol hexaki...	Mus musculus
P0C644	95.2	Inositol hexaki...	Rattus norvegicus
NP_001074252	94.9	histidine acid ...	Rattus norvegicus
XP_001076748	93.2	similar to leth...	Rattus norvegicus
A7Z050	88.2	Inositol hexaki...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129140	8e-218	65.6	mKIAA0433

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000560 396 912 PF00328 Histidine acid phosphatase

ScanRegExp IPR000560 397 411 PS00616 Histidine acid phosphatase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000560	396	912	PF00328	Histidine acid phosphatase
ScanRegExp	IPR000560	397	411	PS00616	Histidine acid phosphatase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1090 bp
Genome contig ID	gi66880554r_120724413
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACATGACAAGTGCTCAATAAACACAAAATAATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACGAGGGGGTGTGACTCCTTTGTGACCTTTGTGAACTCAAGAATGAATA

Gene/Protein Characteristic Table for mKIAA0377

Features of the cloned DNA sequence

Features of the protein sequence