| HUGE |
Gene/Protein Characteristic Table for KIAA0361 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01073 |
|---|---|
| Accession No. : | AB002359 |
| Description : | Phosphoribosylformylglycinamidine synthase. |
| HUGO Gene Name : | phosphoribosylformylglycinamidine synthase (PFAS) |
| Clone Name : | hh00072 [Vector Info] |
| Flexi ORF Clone : | pF1KA0361
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5338 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1221 bp Genome contig ID gi51511734f_7997902 PolyA signal sequence
(AATAAA,-22)
TCCCCGCCTTTTCAATAAAGGATGAATGAAGGTTGFlanking genome sequence
(116628 - 116677)
ACTGCATTGCCTGGGGTCCACAGATGGTGAGGGGGGCTGGGCGCACCCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 8093362 8114528 28 99.6 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1371 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : TTATTGAAAAGGCGGGGAGAG | |
| : CACTTACTGCATTGACTGTTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : GeneBridge 4 | |
| : TTATTGAAAAGGCGGGGAGAG | |
| : CACTTACTGCATTGACTGTTG | |
| : 210 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
