ROUGE |
Gene/Protein Characteristic Table for mKIAA0361 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172938 |
---|---|
Weakly similar to phosphoribosylformylglycinamidine synthase (Fragment). | |
mic05059 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4500 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2263 bp Genome contig ID gi65527427r_68611487 PolyA signal sequence
(ATTAAA,-17) +----*----+----*----+----*----+----
AACTGTAGTTTTGCTGCTATTAAAAATCATAATGTFlanking genome sequence
(99872 - 99823) ----+----*----+----*----+----*----+----*----+----*
AAATGTCTGTTTTCCGATGGCCTTAGACCCCAAGAGGATCGTGACCCACA
KIAA Alignment based on: KIAA0361 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..2237
Length: 744 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |