HUGE

Gene/Protein Characteristic Table for KIAA0349

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07273
Accession No. :	AB002347
Description :	E3 ubiquitin-protein ligase UBR2.
HUGO Gene Name :	ubiquitin protein ligase E3 component n-recognin 2 (UBR2)
Clone Name :	hg01561 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6158 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1275 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX04095	99.9	ubiquitin prote...	Homo sapiens
CAI95685	99.9	ubiquitin prote...	Homo sapiens
Q8IWV8	99.9	E3 ubiquitin-pr...	Homo sapiens
BAG64977	99.8	unnamed protein...	Homo sapiens
XP_001088394	98.0	similar to ubiq...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095944	3.1e-16	25.2	KIAA2024

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR000408 957 967 PS00626 Regulator of chromosome condensation

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR000408	957	967	PS00626	Regulator of chromosome condensation

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CCCTGATATGGAAAGCGTATG

Primer_r
: CTGGTGTTAAGCTAGTTGTCT

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCTGATATGGAAAGCGTATG
Primer_r	: CTGGTGTTAAGCTAGTTGTCT
PCR product length	: 118 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0349

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information