ROUGE

Gene/Protein Characteristic Table for mKIAA0349

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122254
Description :	Ubiquitin ligase E3 alpha-II (Fragment).
Clone Name :	mbg00271 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6521 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 111 bp

Genome contig ID gi65550231r_44343314
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
TCGGCTGAATCTATTTTGAAATAAATTCTTTATTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGCTTTTCTTCCCAGTTTTATTTTTCTAGTCTGGCTCCAGGGACTGATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0349 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0349	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2378..3607, 3636..4424, 4431..6410
Length: 1332 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH31403	97.4	Ubr2 protein [M...	Mus musculus
BAE27917	96.8	unnamed protein...	Mus musculus
AAL32102	96.9	ubiquitin ligas...	Mus musculus
Q6WKZ8	96.9	E3 ubiquitin-pr...	Mus musculus
BAE25301	97.9	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR000408 1014 1024 PS00626 Regulator of chromosome condensation

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR000408	1014	1024	PS00626	Regulator of chromosome condensation

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	111 bp
Genome contig ID	gi65550231r_44343314
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TCGGCTGAATCTATTTTGAAATAAATTCTTTATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCTTTTCTTCCCAGTTTTATTTTTCTAGTCTGGCTCCAGGGACTGATA

Gene/Protein Characteristic Table for mKIAA0349

Features of the cloned DNA sequence

Features of the protein sequence