HUGE

Gene/Protein Characteristic Table for KIAA0317

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00503
Accession No. :	AB002315
Description :
HUGO Gene Name :
Clone Name :	hg00276 [Vector Info]
Flexi ORF Clone :	pF1KSDA0317
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5402 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 826 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH60658	97.1	RIKEN cDNA 1110...	Mus musculus
BAE32654	97.1	unnamed protein...	Mus musculus
AAI18075	97.1	Hypothetical pr...	Bos taurus
BAE28198	96.7	unnamed protein...	Mus musculus
XP_001368000	94.8	similar to ReO_...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002310	3.9e-38	34.6	KIAA0312
AB007899	6.2e-31	31.0	KIAA0439
AB037741	8.8e-31	33.4	KIAA1320
D42055	1.6e-30	31.2	KIAA0093
D13635	3.5e-27	30.5	KIAA0010

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001298 71 158 PF00630 Filamin/ABP280 repeat

IPR000569 515 826 PF00632 HECT

HMMSmart IPR000569 484 826 SM00119 HECT

ProfileScan IPR001298 55 161 PS50194 Filamin/ABP280 repeat

IPR000569 486 826 PS50237 HECT

ScanRegExp IPR000408 182 192 PS00626 Regulator of chromosome condensation

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001298	71	158	PF00630	Filamin/ABP280 repeat
IPR000569	515	826	PF00632	HECT
HMMSmart	IPR000569	484	826	SM00119	HECT
ProfileScan	IPR001298	55	161	PS50194	Filamin/ABP280 repeat
IPR000569	486	826	PS50237	HECT
ScanRegExp	IPR000408	182	192	PS00626	Regulator of chromosome condensation

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CATGTCTGGTCTCCTTCAAAG

Primer_r
: GTGGGGAAAAGGTACAATATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CATGTCTGGTCTCCTTCAAAG
Primer_r	: GTGGGGAAAAGGTACAATATG
PCR product length	: 173 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0317

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information