| HUGE |
Gene/Protein Characteristic Table for KIAA1578 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05475 |
|---|---|
| Accession No. : | AB046798 |
| Description : | E3 ubiquitin-protein ligase HUWE1. |
| HUGO Gene Name : | |
| Clone Name : | fj04270 [Vector Info] |
| Source : | Human fetal brain |
| Note : | Please refer to "Gene/Protein Characteristic Table for KIAA0312" because the cDNA sequence of KIAA1578 is included in KIAA0312. |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3670 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1202 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : AACATCATTCGGCTTTTCCTG | |
| : TACTGGGCTGGTTCACAATCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : X |
| : CCR | |
| : CAGAGCAGTGACTTTGATACG | |
| : GAGGTAGGCATTAAAGGTTTG | |
| : 218(1.6k) bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |