| HUGE |
Gene/Protein Characteristic Table for KIAA0293 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | |
| Product ID : | ORK00499 |
|---|---|
| Accession No. : | AB006631 |
| Description : | Homeobox protein cut-like 2. |
| HUGO Gene Name : | cut-like homeobox 2 (CUX2) |
| Clone Name : | hg03205 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0293
![]() |
| Source : | Human adult brain |
| Note : | We replaced ha06241, former representative clones for KIAA0293 with hg03205. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6841 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2227 bp Genome contig ID gi89161190f_109856289 PolyA signal sequence
(AATACA,-18) +----*----+----*----+----*----+----
CTGTAAACGAGTCGCTAAATACAGAATTGTATAATFlanking genome sequence
(416452 - 416501) ----+----*----+----*----+----*----+----*----+----*
AATTCTGGGTGTCTTGCTTCTTTGTTCTGGGGCTAGGAGTACAAACTGGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 109956212 110272739 22 99.6 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1505 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |