ROUGE

Gene/Protein Characteristic Table for mKIAA0293

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC065113
Description :	Homeobox protein Cux-2.
Clone Name :	mpk03943 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 678 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 421 bp

Genome contig ID gi65498774r_120912525
PolyA signal sequence
(TATAAA,-9)
+----*----+----*----+----*----+----
CCGATGCTGTTTTGATATTAGAGAGTTATAAAGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGATGCTGTCACTGCTGTCGTGGAGCAGACACAGAAGTTGTGTCCTTTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0293 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0293	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..254
Length: 84 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE24497	1e-23	100.0	unnamed protein...	Mus musculus
P70298	2.9e-23	100.0	Homeobox protei...	Mus musculus
AAH65113	2.9e-23	100.0	Cut-like homeob...	Mus musculus
EDM13712	3.9e-21	92.9	cut-like 2 (Dro...	Rattus norvegicus
ABQ22618	3.7e-19	84.5	homeobox protei...	Callithrix jacchus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	421 bp
Genome contig ID	gi65498774r_120912525
PolyA signal sequence (TATAAA,-9)	+--------+--------+----*----+---- CCGATGCTGTTTTGATATTAGAGAGTTATAAAGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATGCTGTCACTGCTGTCGTGGAGCAGACACAGAAGTTGTGTCCTTTTT

Gene/Protein Characteristic Table for mKIAA0293

Features of the cloned DNA sequence

Features of the protein sequence