HUGE

Gene/Protein Characteristic Table for KIAA0264

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00483
Accession No. :	D87453
Description :	Mitochondrial 28S ribosomal protein S27.
HUGO Gene Name :	mitochondrial ribosomal protein S27 (MRPS27)
Clone Name :	ha07040 [Vector Info]
Flexi ORF Clone :	pF1KSDA0264
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2635 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1385 bp

Genome contig ID gi51511721r_71451107
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AAAGCCTCTGGAAATAAATGTTCCGGGATCATGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTGTACTCTTTATCTTTGGGGAAAGGGAGGAGGGAGAGGGACTCATTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 71551107 71651809 11 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 415 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09682	1e-159	100.0	mitochondrial 2...	synthetic construct
Q92552	3.8e-159	99.8	28S ribosomal p...	Homo sapiens
CAH92755	3.7e-158	99.0	hypothetical pr...	Pongo abelii
XP_001098829	1.3e-150	94.4	similar to mito...	Macaca mulatta
XP_001154270	3.7e-139	93.7	mitochondrial r...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GAAAATGAGAGATGGGTTGGG
Primer_r	: CTTAAGGGCAACACTACATAG
PCR product length	: 147 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1385 bp
Genome contig ID	gi51511721r_71451107
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAAGCCTCTGGAAATAAATGTTCCGGGATCATGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGTACTCTTTATCTTTGGGGAAAGGGAGGAGGGAGAGGGACTCATTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	71551107	71651809	11	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0264

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information