ROUGE

Gene/Protein Characteristic Table for mKIAA0264

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172922
Description :	mitochondrial ribosomal protein S27.
Clone Name :	mth02320 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 5648 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3183 bp

Genome contig ID gi65535943f_95496703
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
GCCTCCCCAATAAATCCTACCCATGTGGGCTGTTG
Flanking genome sequence
(107787 - 107836)
----+----*----+----*----+----*----+----*----+----*
TGTGGTGTGATTTTGTGGCATTCCTTGGCCAGTCACCTCAAGAACCCTTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0264 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0264	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2001..2465
Length: 154 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH49149	1.1e-54	97.3	Mrps27 protein ...	Mus musculus
Q8BK72	1.7e-54	97.3	28S ribosomal p...	Mus musculus
NP_776118	1.7e-54	97.3	mitochondrial r...	Mus musculus
EDL00832	1.8e-53	95.9	mitochondrial r...	Mus musculus
EDM10173	5.3e-49	88.4	mitochondrial r...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3183 bp
Genome contig ID	gi65535943f_95496703
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- GCCTCCCCAATAAATCCTACCCATGTGGGCTGTTG
Flanking genome sequence (107787 - 107836)	----+--------+--------+--------+--------+----* TGTGGTGTGATTTTGTGGCATTCCTTGGCCAGTCACCTCAAGAACCCTTA

Gene/Protein Characteristic Table for mKIAA0264

Features of the cloned DNA sequence

Features of the protein sequence