| HUGE |
Gene/Protein Characteristic Table for KIAA0260 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01063 |
|---|---|
| Accession No. : | D87449 |
| Description : | UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter. |
| HUGO Gene Name : | solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 (SLC35D1) |
| Clone Name : | ha07062 [Vector Info] |
| Flexi ORF Clone : | pF1KA0260
![]() |
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5918 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4764 bp Genome contig ID gi89161185r_67137653 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TTTTTGTAATGGTGTAAAATAAATACTTTTTCCTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAACAAGTATTAAAATTCCTTTGTAACTGCATACAGAGACTAATCCAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 67237653 67292370 13 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 383 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : Genebridge 4 | |
| : TTGAAAGCACTTGACCCCATG | |
| : CATCTTGAAAGTAAGACCTAG | |
| : 121 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |