HUGE

Gene/Protein Characteristic Table for KIAA0258

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00481
Accession No. :	D87447
Description :
HUGO Gene Name :
Clone Name :	ha07053 [Vector Info]
Flexi ORF Clone :	pF1KSDA0258
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6313 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5052 bp

Genome contig ID gi89161216f_35639340
PolyA signal sequence
(AATAAA,-11)
+----*----+----*----+----*----+----
AAGTAATTTTGGTGGATTTTTAAAAATAAAAAAAT
Flanking genome sequence
(108584 - 108633)
----+----*----+----*----+----*----+----*----+----*
AAAAATAGAAAAGTTGCACAATCTAATTCAATATTTGACTTAAAACCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 35739340 35747922 9 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 410 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_001073965	2.3e-172	100.0	RGP1 retrograde...	Homo sapiens
XP_001084588	2.1e-171	99.8	hypothetical pr...	Macaca mulatta
XP_001497777	6.8e-164	97.7	RGP1 retrograde...	Equus caballus
BAF82255	7.5e-164	99.7	unnamed protein...	Homo sapiens
XP_001928680	2.1e-162	98.7	RGP1 retrograde...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014848 59 351 PF08737 Rgp1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014848	59	351	PF08737	Rgp1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTAGGAGTAGGGGGAGTTATG
Primer_r	: GCAGACAGTAATCCAAGACGC
PCR product length	: 136 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	5052 bp
Genome contig ID	gi89161216f_35639340
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- AAGTAATTTTGGTGGATTTTTAAAAATAAAAAAAT
Flanking genome sequence (108584 - 108633)	----+--------+--------+--------+--------+----* AAAAATAGAAAAGTTGCACAATCTAATTCAATATTTGACTTAAAACCAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	35739340	35747922	9	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0258

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information