| HUGE |
Gene/Protein Characteristic Table for KIAA0256 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01062 |
|---|---|
| Accession No. : | D87445 |
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | eg00512 [Vector Info] |
| Flexi ORF Clone : | pF1KA0256
![]() |
| Source : | |
| Note : | We replaced ha04798, former representative clones for KIAA0256 with eg00512. (2001/10/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6779 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3474 bp Genome contig ID gi51511731r_46968259 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AAAAAACTAGCAAAATTAGTGTGAGTTATAACATGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGGGATTTTCATCTTTTGCTGTATGAAGGATAATTGTTATATCACATTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 r 47068259 47125922 17 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1065 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 15 |
| : Genebridge 4 | |
| : CTCATCCCTTCCAACCTTTAC | |
| : GTACAGAAGAATCCCCACTAG | |
| : 338 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |