ROUGE |
Gene/Protein Characteristic Table for mKIAA0256 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172920 |
---|---|
mib19092 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6642 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3257 bp Genome contig ID gi66880554r_125150862 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TTAATTGTAGTGCTCTAATAAAAACTAGCAAAACTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATGGATTATACCAAGAGAGAATTTCTGTGTTCTTTTTCTATGTGAAGGA
KIAA Alignment based on: KIAA0256 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1..1512, 1520..3385
Length: 1125 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |