| HUGE |
Gene/Protein Characteristic Table for KIAA0252 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00479 |
|---|---|
| Accession No. : | D87440 |
| Description : | RNA polymerase-associated protein RTF1 homolog. |
| HUGO Gene Name : | |
| Clone Name : | ha07048s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0252
![]() |
| Source : | Myeloblast cell line (KG-1) |
| Note : | We replaced ha07048, former representative clones for KIAA0252 with ha07048s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4404 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2293 bp Genome contig ID gi51511731f_39396653 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TTATGGCTGTGTAATAAAATTTTTATTAAAACTGCFlanking genome sequence
(165819 - 165868) ----+----*----+----*----+----*----+----*----+----*
ATCACACTGTAGCCACTTTGCCACCACCTCCCCACATGTAGCCGCTGAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 39496628 39562470 18 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 702 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 15 |
| : Genebridge 4 | |
| : GGCAAAGGAGTGTGATGGAC | |
| : GTCCAGGCAATGTTAACAGTC | |
| : 118 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |