| HUGE |
Gene/Protein Characteristic Table for KIAA0244 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00040 |
|---|---|
| Accession No. : | D87685 |
| Description : | PHD finger protein 3. |
| HUGO Gene Name : | |
| Clone Name : | ha04644s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA0244
|
| Source : | Myeloblast cell line (KG-1) |
| Note : | We replaced ha04644, former representative clones for KIAA0244 with ha04644s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6936 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 801 bp Genome contig ID gi89161210f_64314401 PolyA signal sequence
(AGTAAA,-28)
ATTCAGTAGTAAAAGAATTTCTTCTTTAAAGCTTTFlanking genome sequence
(167965 - 168014)
AATTACCTTCAGACATTGATTTTTTGTTACTCAGCCAAGAACATATAGAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 64414401 64482364 15 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 2044 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : Genebridge 4 | |
| : CATCCCTTCTTCATACCAACG | |
| : TTGGGCTTCTGATTCTTGGTC | |
| : 351 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
