| HUGE |
Gene/Protein Characteristic Table for KIAA0240 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01661 |
|---|---|
| Accession No. : | D87077 |
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | fg03390 [Vector Info] |
| Flexi ORF Clone : | pF1KA0240
|
| Source : | Human fetal brain |
| Note : | We replaced ha04715, former representative clones for KIAA0240 with fg03390. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6512 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2945 bp Genome contig ID gi89161210f_42722674 PolyA signal sequence
(TATAAA,-15)
ATACATTTTGTAAAAATATTTATAAAATGTTTTGTFlanking genome sequence
(221434 - 221483)
AAAAAAAAAAAAACTATAACAAATTGCAGTTTATTTTGTTATGTTGGATA
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 42822674 42944106 15 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1087 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : Genebridge 4 | |
| : TGTGTCCTTAAGTACTTCCTG | |
| : TAAAGCCCACACCACACTGAC | |
| : 172 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
