| HUGE | 
| Gene/Protein Characteristic Table for KIAA0214 | 
| Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00462 | 
|---|---|
| Accession No. : | D86987 | 
| Description : | Mitofusin-2. | 
| HUGO Gene Name : | mitofusin 2 (MFN2) | 
| Clone Name : | ha04778 [Vector Info] | 
| Flexi ORF Clone : | pF1KSDA0214  | 
| Source : | Myeloblast cell line (KG-1) | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 4550 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | NO | 
| Warning for coding interruption: | NO | 
Length of 3'UTR 1954 bp Genome contig ID gi89161185f_11862956 PolyA signal sequence 
(AATAAA,-32)
TAAAATAAAACCTAGTTGGAAATCCAAAAAAAAACFlanking genome sequence None 
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 11962956 11996152 19 99.5 Terminal No-hit 
| Features of the protein sequence | Description | |
|---|---|---|
Length: 790 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
 
    | Expression profile | Description | |
|---|---|---|
| RH mapping information | Description | |
|---|---|---|
| : 1 | 
| : Genebridge 4 | |
| : CCTGTTGTGTGGGGCGAAGTG | |
| : TGCTGTGAAGTGGCCCCTGTC | |
| : 104 bp | |
| : 95 °C | 
| How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage   | |