ROUGE |
Gene/Protein Characteristic Table for mKIAA0214 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122220 |
---|---|
Transmembrane GTPase MFN2. | |
mbg06117 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5438 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1790 bp Genome contig ID gi65493515r_146265962 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
TTGGAAACTAAAATAAAGCCCCATTTGTGACCCTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TGTGAGCTCTCTGCCTGCAGTAGTCTGGTCTGAGAAGAAAGGACATGGCC
KIAA Alignment based on: KIAA0214 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 204..857, 1954..2394, 2413..3648
Length: 776 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |