HUGE

Gene/Protein Characteristic Table for KIAA0210

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00459
Accession No. :	D86965
Description :	TBC1 domain family member 5.
HUGO Gene Name :	TBC1 domain family, member 5 (TBC1D5)
Clone Name :	ha02313 [Vector Info]
Flexi ORF Clone :	pF1KSDA0210
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6611 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2559 bp

Genome contig ID gi89161205r_17074903
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
AGTTACAGTGCTATTAAAGAATATGTGCTCCTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TATTATATTATCAGATACTTATGTTTAATTGTACATTTTTTAAATCCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 17174903 17757403 21 99.3 Internal No-hit

Features of the protein sequence	Description

Length: 801 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92609	100.0	TBC1 domain fam...	Homo sapiens
EAW64285	99.9	TBC1 domain fam...	Homo sapiens
XP_001161013	99.9	TBC1 domain fam...	Pan troglodytes
EAW64284	99.6	TBC1 domain fam...	Homo sapiens
XP_001084887	98.2	TBC1 domain fam...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000195 128 389 PF00566 RabGAP/TBC

HMMSmart IPR000195 84 390 SM00164 RabGAP/TBC

ProfileScan IPR000195 87 365 PS50086 RabGAP/TBC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	128	389	PF00566	RabGAP/TBC
HMMSmart	IPR000195	84	390	SM00164	RabGAP/TBC
ProfileScan	IPR000195	87	365	PS50086	RabGAP/TBC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 356 VVWDALFADGLSLGLVDYIFVAM 378 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	356	VVWDALFADGLSLGLVDYIFVAM	378	PRIMARY	23

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GTGTGCTGTTAGGTGAAAGAC
Primer_r	: AAACTCAGGAATGCACTACTC
PCR product length	: 177 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2559 bp
Genome contig ID	gi89161205r_17074903
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- AGTTACAGTGCTATTAAAGAATATGTGCTCCTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATTATATTATCAGATACTTATGTTTAATTGTACATTTTTTAAATCCTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	17174903	17757403	21	99.3	Internal No-hit

Gene/Protein Characteristic Table for KIAA0210

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information