HUGE

Gene/Protein Characteristic Table for KIAA0203

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00035
Accession No. :	D86958
Description :	RB1-inducible coiled-coil protein 1.
HUGO Gene Name :	RB1-inducible coiled-coil 1 (RB1CC1)
Clone Name :	ha02320 [Vector Info]
Flexi ORF Clone :	pF1KA0203
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6614 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1323 bp

Genome contig ID gi51511724r_53597572
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTGACAAGTTAATGAATAAATGAACAAATGATTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATGTTTCTATTTAATCTTTCCATGACATCTTTATGCAAAGACTGTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 53697572 53789536 24 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1593 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW86720	100.0	RB1-inducible c...	Homo sapiens
NP_001077086	99.9	Rb1-inducible c...	Homo sapiens
AAH17556	99.8	RB1-inducible c...	Homo sapiens
Q8TDY2	99.7	RB1-inducible c...	Homo sapiens
BAB69690	99.7	Rb1-inducible c...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13629	5.2e-05	21.8	KIAA0004
AB020673	6.6e-05	22.2	KIAA0866

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTGAGTGATTGCTGGGAAGTG
Primer_r	: CTCATCCAACTCAACTAACTC
PCR product length	: 199 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1323 bp
Genome contig ID	gi51511724r_53597572
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTGACAAGTTAATGAATAAATGAACAAATGATTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATGTTTCTATTTAATCTTTCCATGACATCTTTATGCAAAGACTGTTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	53697572	53789536	24	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0203

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information