HUGE

Gene/Protein Characteristic Table for KIAA0186

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00448
Accession No. :	D80008
Description :	DNA replication complex GINS protein PSF1.
HUGO Gene Name :	GINS complex subunit 1 (Psf1 homolog) (GINS1)
Clone Name :	ha03207 [Vector Info]
Flexi ORF Clone :	pF1KSDA0186
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 226 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001107106	6.1e-94	95.5	similar to DNA ...	Macaca mulatta
AAH12542	3.3e-86	99.5	GINS1 protein [...	Homo sapiens
XP_848652	6.3e-84	95.4	similar to DNA ...	Canis lupus fam...
Q9CZ15	1.7e-82	93.4	DNA replication...	Mus musculus
A4IFH4	3.2e-81	92.9	DNA replication...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR005339 31 168 PD022798 GINS complex

HMMPfam IPR005339 31 224 PF03651 GINS complex

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR005339	31	168	PD022798	GINS complex
HMMPfam	IPR005339	31	224	PF03651	GINS complex

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTGTTGGGCACCTTGATTGAG
Primer_r	: TAATACCTAGGAAGACAGACC
PCR product length	: 117 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0186

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information