HUGE

Gene/Protein Characteristic Table for KIAA0183

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04947
Accession No. :	D80005
Description :	UPF0318 protein FAM120A.
HUGO Gene Name :	family with sequence similarity 120A (FAM120A)
Clone Name :	ha02726 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4904 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1566 bp

Genome contig ID gi89161216f_95154038
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTACAATGCTTAATAAAAATCTTTATTCTTTTAGT
Flanking genome sequence
(214174 - 214223)
----+----*----+----*----+----*----+----*----+----*
ATAAAGTATGGCGTGGCTTTTAAATTCACTTGTAAAAGCTAATTTTATAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 95254038 95368210 18 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1111 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NZB2	100.0	Constitutive co...	Homo sapiens
EAW62864	99.9	chromosome 9 op...	Homo sapiens
XP_001056595	96.6	similar to Prot...	Rattus norvegicus
AAI58135	96.4	BC010304 protei...	Mus musculus
AAI67198	96.4	CDNA sequence B...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058741	1.6e-06	24.2	KIAA1838

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CACGTCAAGGTTGCACAGAGC
Primer_r	: GTGCATAATCAGAGTCATACG
PCR product length	: 106 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1566 bp
Genome contig ID	gi89161216f_95154038
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTACAATGCTTAATAAAAATCTTTATTCTTTTAGT
Flanking genome sequence (214174 - 214223)	----+--------+--------+--------+--------+----* ATAAAGTATGGCGTGGCTTTTAAATTCACTTGTAAAAGCTAATTTTATAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	95254038	95368210	18	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0183

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information