| HUGE |
Gene/Protein Characteristic Table for KIAA0161 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00437 |
|---|---|
| Accession No. : | D79983 |
| Description : | Ubiquitin-conjugating enzyme 7-interacting protein 4. |
| HUGO Gene Name : | ring finger protein 144A (RNF144A) |
| Clone Name : | ha02800 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0161
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5559 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 4332 bp Genome contig ID gi89161199f_6875126 PolyA signal sequence
(AATACA,-18)
GTTTGATTTGTAATTTCAATACATATTTTAAATGTFlanking genome sequence
(226551 - 226600)
ATTGTGTCTTACGTAGTTTGTCCCCCCCTTTAGCAGGGATTCCTTTTTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 6975068 7101675 9 99.2 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 326 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : Stanford G3 | |
| : CCATGCCTGCCCTTTCTTTCC | |
| : TTTGTTTCACCACCACTTGTC | |
| : 129 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
