HUGE |
Gene/Protein Characteristic Table for KIAA1386 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01163 |
---|---|
Accession No. : | AB037807 |
Description : | Ankyrin repeat and IBR domain-containing protein 1 (Fragment). |
HUGO Gene Name : | ankyrin repeat and IBR domain containing 1 (ANKIB1) |
Clone Name : | fj06274 [Vector Info] |
Flexi ORF Clone : | pF1KA1386
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4030 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 384 bp Genome contig ID gi89161213f_91613484 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AGGCTTACTCCCTAATCTTTGGGTGGCTTTCCTTTFlanking genome sequence
(253101 - 253150) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGTTTTCTTCATTCTAGAAATTTATTTTGGATAAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 91713484 91866583 20 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1214 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 171 | 183 | PR01415 | Ankyrin |
IPR002110 | 282 | 294 | PR01415 | Ankyrin | |
HMMPfam | IPR002110 | 170 | 202 | PF00023 | Ankyrin |
IPR002110 | 269 | 301 | PF00023 | Ankyrin | |
IPR002867 | 527 | 603 | PF01485 | Zinc finger | |
IPR002867 | 643 | 677 | PF01485 | Zinc finger | |
IPR003903 | 975 | 992 | PF02809 | Ubiquitin interacting motif | |
HMMSmart | IPR002110 | 170 | 199 | SM00248 | Ankyrin |
IPR002110 | 269 | 298 | SM00248 | Ankyrin | |
IPR001841 | 458 | 506 | SM00184 | Zinc finger | |
IPR002867 | 527 | 603 | SM00647 | Zinc finger | |
IPR002867 | 626 | 690 | SM00647 | Zinc finger | |
IPR001841 | 644 | 768 | SM00184 | Zinc finger | |
ProfileScan | IPR002110 | 170 | 202 | PS50088 | Ankyrin |
IPR002110 | 170 | 322 | PS50297 | Ankyrin | |
IPR002110 | 269 | 301 | PS50088 | Ankyrin | |
IPR001841 | 458 | 504 | PS50089 | Zinc finger | |
IPR003903 | 976 | 995 | PS50330 | Ubiquitin interacting motif |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACAGAGGAGATGGTTCAGATG | |
: ATCAAGCATACTCCACCTAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |