HUGE

Gene/Protein Characteristic Table for KIAA0160

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07031
Accession No. :	D63881
Description :	Polycomb protein SUZ12.
HUGO Gene Name :	suppressor of zeste 12 homolog (Drosophila) (SUZ12)
Clone Name :	ha03912s1 [Vector Info]
Flexi ORF Clone :	pF1KA0160
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha03912, former representative clones for KIAA0160 with ha03912s1. (2008/8/27)

Features of the cloned DNA sequence	Description

Length: 4441 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2027 bp

Genome contig ID gi51511734f_27188278
PolyA signal sequence
(CATAAA,-18)
+----*----+----*----+----*----+----
AATCAAATGATTTTGTACATAAAGTTCAATAATAT
Flanking genome sequence
(163886 - 163935)
----+----*----+----*----+----*----+----*----+----*
AAAAGCTGTATTCTGTTTTGGGGTTTTTTTGTTATTATGCATTGTTAACA

Features of the protein sequence	Description

Length: 803 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL15617	94.0	suppressor of z...	Mus musculus
Q15022	100.0	Polycomb protei...	Homo sapiens
BAF82703	99.7	unnamed protein...	Homo sapiens
XP_001174690	99.5	joined to JAZF1...	Pan troglodytes
XP_582605	99.2	similar to Poly...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR007087 514 535 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR007087	514	535	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TACTGGCACATTAACAAGCAC
Primer_r	: ATCCAGAGGCAAAAATCAGAG
PCR product length	: 480 bp
PCR conditions	: 95 °C15 sec62 °C60 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2027 bp
Genome contig ID	gi51511734f_27188278
PolyA signal sequence (CATAAA,-18)	+--------+--------+----*----+---- AATCAAATGATTTTGTACATAAAGTTCAATAATAT
Flanking genome sequence (163886 - 163935)	----+--------+--------+--------+--------+----* AAAAGCTGTATTCTGTTTTGGGGTTTTTTTGTTATTATGCATTGTTAACA

Gene/Protein Characteristic Table for KIAA0160

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information