HUGE

Gene/Protein Characteristic Table for KIAA0153

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00432
Accession No. :	D63487
Description :	Tubulin--tyrosine ligase-like protein 12.
HUGO Gene Name :	tubulin tyrosine ligase-like family, member 12 (TTLL12)
Clone Name :	ha00521 [Vector Info]
Flexi ORF Clone :	pF1KSDA0153
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3394 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1475 bp

Genome contig ID gi89161203r_41792573
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CTCAGTTCGTGCTGCAATAAAGGCCATCTTCTCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTCTGCCCTCCTTTCTCTTTGGACCCTGGAGCCACAGGCTCAGCCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 41892573 41913003 15 99.7 Internal No-hit

Features of the protein sequence	Description

Length: 638 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14166	100.0	Tubulin--tyrosi...	Homo sapiens
XP_001171890	99.1	tubulin tyrosin...	Pan troglodytes
CAQ09718	100.0	tubulin tyrosin...	Homo sapiens
XP_001104848	97.5	similar to CG15...	Macaca mulatta
XP_515178	99.2	tubulin tyrosin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D79995	0.001	21.6	KIAA0173

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004344 340 636 PF03133 Tubulin-tyrosine ligase

ProfileScan IPR004344 294 638 PS51221 Tubulin-tyrosine ligase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004344	340	636	PF03133	Tubulin-tyrosine ligase
ProfileScan	IPR004344	294	638	PS51221	Tubulin-tyrosine ligase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CCGCCTTATCACCCATTCCAG
Primer_r	: AGATACTGATTTCCCTGTTGG
PCR product length	: 141 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1475 bp
Genome contig ID	gi89161203r_41792573
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CTCAGTTCGTGCTGCAATAAAGGCCATCTTCTCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCTGCCCTCCTTTCTCTTTGGACCCTGGAGCCACAGGCTCAGCCTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	41892573	41913003	15	99.7	Internal No-hit

Gene/Protein Characteristic Table for KIAA0153

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information