HUGE

Gene/Protein Characteristic Table for KIAA0173

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00444
Accession No. :	D79995
Description :	Tubulin--tyrosine ligase-like protein 4.
HUGO Gene Name :	tubulin tyrosine ligase-like family, member 4 (TTLL4)
Clone Name :	ha02346 [Vector Info]
Flexi ORF Clone :	pF1KSDA0173
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4831 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1024 bp

Genome contig ID gi89161199f_219210546
PolyA signal sequence
(AGTAAA,-21)
+----*----+----*----+----*----+----
CCTCCTCTAGACTCAGTAAACAGTGACTATTCAAT
Flanking genome sequence
(117836 - 117885)
----+----*----+----*----+----*----+----*----+----*
AAATGTTGACTGAGTGAACTGTATTTACAGAGATCTCAAAGGACCCCAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 219283975 219328380 20 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1203 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09639	100.0	tubulin--tyrosi...	synthetic construct
Q14679	99.9	Tubulin polyglu...	Homo sapiens
AAH21707	99.6	Tubulin tyrosin...	Homo sapiens
XP_516095	99.4	tubulin tyrosin...	Pan troglodytes
XP_001158991	99.0	tubulin tyrosin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023215	8.3e-38	38.0	KIAA0998

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004344 655 950 PF03133 Tubulin-tyrosine ligase

ProfileScan IPR004344 608 951 PS51221 Tubulin-tyrosine ligase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004344	655	950	PF03133	Tubulin-tyrosine ligase
ProfileScan	IPR004344	608	951	PS51221	Tubulin-tyrosine ligase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GCTTGGTAGGTGGGTTTCAGG
Primer_r	: AGAGGAGGGAGGTAGAATCAG
PCR product length	: 102 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1024 bp
Genome contig ID	gi89161199f_219210546
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- CCTCCTCTAGACTCAGTAAACAGTGACTATTCAAT
Flanking genome sequence (117836 - 117885)	----+--------+--------+--------+--------+----* AAATGTTGACTGAGTGAACTGTATTTACAGAGATCTCAAAGGACCCCAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	219283975	219328380	20	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0173

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information